BIOMEDICAL REPORTS 1: 285-293, 2013
Combinatorial gene targeting hTERT and BI‑1 in CNE‑2 nasopharyngeal carcinoma cell line YAN LIANG*, XIANGYONG LI*, RONGWEN LIN*, XIN ZHANG, HUIMIN WANG, NING TAN, KESHEN LI, XUDONG TANG, KEYUAN ZHOU and TAO LI Key Laboratory for Medical Molecular Diagnostics of Guangdong Province, Guangdong Medical College, Dongguan, Guangdong 523808, P.R. China Received August 14, 2012; Accepted October 16, 2012 DOI: 10.3892/br.2012.39 Abstract. Nasopharyngeal carcinoma (NPC) is a common malignant tumor. In recent studies, we demonstrated that overexpression of the Bax inhibitor‑1 (BI‑1) induces cell transformation in NIH3T3 cells and that knockdown of BI‑1 and human telomerase reverse transcriptase (hTERT) gene expression suppresses NPC cell proliferation and induces apoptosis. To evaluate the combination anti‑tumor effects of siRNAs against hTERT and BI‑1 in the CNE‑2 NPC cell line, combined and separate short‑hairpin (sh)RNA plasmids targeting hTERT and BI‑1, respectively, were constructed. hTERT and BI‑1 mRNA and protein levels were examined by real‑time polymerase chain reaction (PCR) and western blot analysis. Cell proliferation, colony formation and migration ability were measured by 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT), soft agar and wound healing assay. Cell apoptosis was observed by flow cytometry, Hoechst 33258 staining and caspase‑3 activity. hTERT, BI‑1 and combined shRNA plasmids were injected into xenograft NPC tumor tissues, and expression of hTERT and BI‑1 was detected by real‑time PCR and immunohistochemistry. Tumor growth was measured by tumor volume and apoptosis invivo was confirmed by TdT‑mediated dUTP nick end‑labeling ( TUNEL). Our results showed that combined shRNA specific for hTERT and BI‑1 markedly suppressed hTERT and BI‑1 gene expression invitro and invivo. In addition, CNE‑2 cell proliferation was inhibited invitro as well as invivo. Following the knockdown of the two gene expressions, CNE‑2 exhibited a decrease in colony formation and migration ability and an increase in the apop-
Correspondence to: Professor Tao Li, Key Laboratory for Medical Molecular Diagnostics of Guangdong Province, Guangdong Medical College, 1 Xincheng Broadway, Dongguan, Guangdong 523808, P.R.China E‑mail: [emailprotected] *
Contributed equally
Key words: human telomerase reverse transcriptase, Bax inhibitor‑1, short‑hairpin RNA, gene therapy, nasopharyngeal carcinoma
totic rate compared to the control groups. Our invitro and invivo study showed that the combinative silencing of the two genes enhanced the therapeutic effect compared to the silencing of each individual shRNA. These data suggested that combinatorial gene therapy targeting hTERT and BI‑1 may be beneficial as a tumor therapy strategy against human NPCs. Introduction Nasopharyngeal carcinoma (NPC) is a common malignant tumor in southern China, particularly in the Guangdong population (1). Genetic as well as environmental factors are known to contribute to NPC tumorigenesis. At present, the standard treatment (the primary treatments) for NPC is radiotherapy, which in certain cases is combined with chemotherapy. However, the disease relapse and metastatic rate remain high(2). Thus, novel modalities of treatment for NPC are needed. Besides conventional therapies, target strategies aimed to reduce the expression of tumor‑related genes have been investigated. Of those, small interfering RNAs (siRNAs) are potentially a curative selection. RNA interference (RNAi) is a natural process through which the expression of a purpose gene can be knocked down theoretically with high specificity and selectivity RNAi(3). It has been used in numerous malignant cancer gene therapies. In colorectal and gastric cancers, knockdown cell division cycle associated 1 (CDCA1) and CDCA1‑kinetochore associated 2 (KNTC2) suppressed cell proliferation and induced apoptosis(4). Downregulation of Wnt2 and β ‑catenin by siRNA suppressed malignant glioma cell growth (5). In addition, chronic lymphocytic leukemia cells induced apoptosis following the silencing of ROR1 and FMOD with siRNA (6). Telomerase is a specific ribonucleoprotein complex that is often highly expressed in various tumors. The induction of human telomerase reverse transcriptase (hTERT) expression results in activity and is involved in the process of human carcinogenesis (7). Knockdown of hTERT by siRNA inhibits human bladder cancer cells (8), hepatocellular carcinoma cells(9) and oral cancer cell proliferation (10). In NPC, 91% of cells demonstrate hTERT expression and 85% exhibit telomerase overexpression (2). Short hairpin (sh)RNA targeted against hTERT inhibits cell viability by regulating
286
LIANG et al: COMBINATIVE shRNA-TREATED NASOPHARYNGEAL CARCINOMA
telomerase activity and its related protein expression in NPC cells (11). A novel anti‑apoptotic gene termed Bax inhibitor‑1 (BI‑1) has been found to represent a new type of regulator of cell death pathways (12). BI‑1 has been found to be overexpressed in several tumors and is involved in tumor progression and malignancy due to its anti‑apoptotic properties (13,14). Recently, we demonstrated that overexpression of BI‑1 induces cell transformation in NIH3T3 cells, and knockdown of BI‑1 and hTERT gene expression by siRNA suppresses NPC cell proliferation and induces apoptosis invivo and invitro (15‑17). Since cancer cells are characterized by multiple genetic alterations the single inhibition of one tumor‑associated gene might not be sufficient as a therapeutic strategy. In the present study, the combination of the anti‑tumor effects of siRNAs against hTERT and BI‑1 were evaluated in CNE‑2 NPC cell lines. Furthermore, inhibition of tumor growth was observed in subcutaneous NPC xenograft mice. Materials and methods Reagents. Dulbecco's modified Eagle's medium (DMEM) completed medium, fetal bovine serum (FBS), Opti‑MEMI medium, TRIzol reagent and Lipofectamine™ 2000 (Lipo) were purchased from Invitrogen (Guangzhou, China). Primary antibody against hTERT, BI‑1 and β ‑actin were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Enhanced chemiluminescence substrate was purchased from Thermo Scientific (Guangzhou, China). The restriction enzyme was purchased from New England Biolabs (Beijing, China). Design and construction of shRNA plasmids. hTERT and BI‑1 RNAi target sequences were used in this study: hTERT: 5'‑gacgtcttcctacgcttca‑3' (GenBank no.: AF015950 Position: 2474‑2492), BI‑1: 5'‑gatcaagattatatctggcactg‑3' (GenBank no.: BC036203, Position: 738‑760). The hTERT and BI‑1 and scramble hairpin‑like double‑stranded oligo DNA was synthesized by Sangon Biotech (Shanghai, China). The restriction enzyme site EcoRI and KpnI for hTERT and NotI and XbaI for BI‑1 were designed on the ends of the oligo DNA. The oligo DNA was cloned in pcDNA3.1(+) (Invitrogen) vector and the correct insert was confirmed by DNA sequence. Cell culture and transfection. Poorly differentiated human CNE‑2 NPC cell line was established and provided by Professor Yi Zeng (18). This cell line was cultured in DMEM completed medium supplemented with 10% FBS, penicillin (100U/l) and streptomycin (100µg/l) (Invitrogen Guangzhou, China) at 37˚C in a humid incubator with 5% CO2. Using the Lipofectamine™ 2000 reagent (Invitrogen), CNE‑2 cells were transfected with (plasmids pcDNA3.1(+) empty vector, sh‑hTERT, sh‑scramble hTERT, sh‑BI‑1, sh‑scramble BI‑1, sh‑hTERT‑BI‑1 and sh‑scramble‑hTERT‑BI‑1), according to the manufacturer's protocol. Real‑time reverse transcription polymerase chain reaction (RT PCR). Primers used in this study were: hTERT: 5'‑agtgtctg gagcaagttgcaaag‑3' and 5'‑cacgacgtagtccatgttca-
caatc‑3', BI‑1: were 5'‑atcattgtaaccaatcctgccagac‑3' and 5'‑agcctcgctctgttgatg tgaa‑3', β ‑actin: 5'‑ tggcacccagcacaatgaa‑3' and 5'‑ctaagtca tagtccgcctagaagca‑3. After 48h of transfection, total RNA was prepared with TRIzol reagent. Quantitative real‑time PCR was performed using One Step SYBR® PrimeScript® RT‑PCR kitII (Takara Biotechnology Co., Ltd., Dalian, China), following the manufacturer's instructions on ABI7500 HT real‑time PCR detection system. The results were normalized for the expression of β‑actin. Western blot analysis. The transfected cells were harvested in RIPA buffer and the protein concentration was determined by Bradford reagent (Bio‑Rad, Guangzhou, China). Total protein (100 µM) was separated on SDS‑PAGE gel and transferred onto a polyvinylidene fluoride membrane (Millipore China Ltd., Guangzhou, China). The membrane was incubated overnight at 4˚C with primary antibodies (1:200 for hTERT and BI‑1, respectively, and 1:500 for β ‑actin). The primary antibody for hTERT (sc‑7212), BI‑1 (sc‑12393) and horseradish perodidase‑conjugated secondary antibody were purchased from Santa Cruz Biotechnology, Inc. The primary antibody (BSAP0060) for β ‑actin was purchased from Bioworld Technology (Shanghai, China). The protein bands were visualized using the enhanced chemiluminescence substrate kit (Thermo, Guangzhou, China). The percentage reduction in band intensity was calculated based on the untreated samples and normalized to β‑actin. Cell proliferation and apoptosis analysis. CNE‑2 cells (5x103) were seeded in 96‑well plates and incubated at 12h for transfection. At 48h after transfection, each well was treated with 10µl 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution [10mg/ml in phosphate‑buffered saline (PBS)] and incubated sequentially at 37˚C. Four hours after incubation, 100µl of dimethyl sulfoxide (DMSO) were added to dissolve the crystals. The plate was oscillated for 10min at room temperature and absorbance was measured at 570 and 630nm. The apoptotic level was performed as previously described (16). Briefly, for Hoechst 33258 fluorescence staining, CNE‑2 cells were seeded in 24‑well plates and treated with 5µl 20µg/ml Hoechst 33258 for 30min in the dark. The morphological change of nuclei in CNE‑2 cells was analyzed and counted under a fluorescent microscope (magnification, x200) in five different fields to discriminate normal and apoptotic cells. Cells were photographed and the images were processed using the Adobe Photoshop software, version 7.0 (Adobe, CA, USA). Flow cytometry followed an Annexin V‑FITC Apoptosis Detection Kit (Nanjin KeyGen Biotech Co., Ltd., Nanjin, China). Briefly, after 48h of plasmid transfection, cells were collected and washed with PBS three times. The cells were suspended in 500µl binding buffer and stained with 5µl Annexin V‑FITC and 5µl propidium iodide for 15min at room temperature in the dark. The cells were examined using a BD FACSCanto II flow cytometer and analyzed using BD FACSDiva software 6. Caspase‑3 activity was determined using a caspase assay kit according to the manufacturer's instructions (Clontech, Mountain View, CA, USA). The samples were read at 405nm in a microplate reader.
BIOMEDICAL REPORTS 1: 285-293, 2013
287
A
B
Figure 1. Downregulation of human telomerase reverse transcriptase (hTERT) and Bax inhibitor‑1 (BI‑1) gene expression after shRNA transfection is shown. hTERT and BI‑1 gene expression in CNE‑2 cells was suppressed following transfection with sequence‑specific short‑hairpin (sh)RNA against hTERT, BI‑1 and a combination of the two gene plasmids. Untreated, transfection reagent Lipofectamine™ 2000, empty vector pcDNA3.1(+) and vector carrying scrambled shRNA sequence was used as the negative control. After transfection CNE‑2 cells were collected and used for RNA and protein isolation, respectively. (A)hTERT and (B) BI‑1 mRNA and protein levels were analyzed using real‑time PCR and western blot analysis. Results of the analysis are shown in the bar graph. The labels for the bars are: control, untreated, lip transfection reagent Lipofectamine™ 2000, pcDNA3.1: empty vector pcDNA3.1(+), hTERT or BI‑1 siRNA: hTERT- or BI‑1-specific shRNA-contained plasmids, hTERT‑BI‑1 siRNA: hTERT‑BI‑1 combination shRNA-contained plasmids, hTERT‑s, BI‑1‑s or hTERT‑BI‑1‑s siRNA: hTERT, BI‑1 or hTERT‑BI‑1 scramble shRNA-containing plasmid. The western blot analysis was stripped and re‑probed with β‑actin antibody to check for equal loading of total protein. Data are shown as the mean±SD of three independent experiments. *P
